Genetic expression speaks as loudly as gene type

The current Nature is carrying the following article about some very positive research at University of Pennsylvania into gene expression.  Where is denial now?  Mr Diamond?  Mr Lewontin?  To be brutally honest, we’ve just been told all this on another thread.  But anyhow ...

Some ethnic differences could be down to the same genes behaving differently.

From dark skin to fiery red hair, the world’s ethnic groups all have characteristic physical features. But how does our genome code for these differences? New research shows that it isn’t just because different groups carry different genes — some of the variation is down to the same genes being expressed differently.

The study is the latest contribution to the popular new field that uses modern genomic tools to unravel the genetic basis of variation between ethnic groups. Such analyses have only become possible recently, thanks to tools such as the International HapMap Project, published last year1, which charts the prevalence of single DNA-letter differences (called single-nucleotide polymorphisms, or SNPs) between different ethnic groups.

Such work has spotted many genetic differences between groups — some of the genes that determine skin or eye colour, for example, have been unpicked. But scientists usually study one trait at a time, and only find a genetic explanation after years of painstaking work.

Richard Spielman, Vivian Cheung and their team at the University of Pennsylvania in Philadelphia, took a much faster approach, screening thousands of traits at once and working back to their genetic roots in mere months.

Express yourself

The team chose a set of 4,197 genes expressed by a single cell line. They then measured the degree to which each gene was active in this cell type in each of three ethnic groups: Caucasians, Chinese and Japanese. The Japanese and Chinese groups gave very similar results, they found. When these were lumped together and compared with the third group, the team found that 1,097 genes, or 25% of the total, were expressed very differently between Asians and Caucasians.

Spielman says the result, published in Nature Genetics2, is remarkable. “It comes as somewhat of a surprise,” he says.

Spielman notes that studying other ethnic groups, genes or cell types might give different results. So this doesn’t mean that, for instance, Caucasians are 25% different from Chinese people. Many other sorts of genetic variation also distinguish individuals and ethnic groups, including additions or deletions of large pieces of DNA.

But adding an understanding of differences in gene expression to the pot should help researchers to unpick why some ethnic groups tend to be more vulnerable to certain diseases than others. Cystic fibrosis disproportionately affects Caucasians, for example, and Tay-Sachs disease tends to be more prevalent among Ashkenazi Jews, French Canadians, and other groups.

“What’s relevant to me is what light this might shed on medical differences,” Spielman says.

Governing behaviour

The differences in gene expression may be due to differences in nearby bits of DNA: a so-called regulatory section of DNA can govern how a nearby gene behaves.

The team scanned the HapMap to find SNPs located close to the genes that were expressed distinctly in the Asian and Caucasian groups. This provides the team with candidates for specific genetic blips that might cause the variation in gene expression.

The work “adds fundamental information to our understanding of how genetic variation between individuals or populations can influence gene expression”, says Steve Scherer of the Hospital for Sick Children and the University of Toronto, Canada. The research is an important step, he says, in understanding human diversity.

Posted by Guessedworker on Tuesday, January 9, 2007 at 06:05 PM in Genetics & Human Bio-Diversity
Comments (12) | Tell a friend

Comments:

Posted by brutally honest brute on January 09, 2007, 06:58 PM | #

“New research shows that it isn’t just because different groups carry different genes — some of the variation is down to the same genes being expressed differently.”

Yeah, but why are the “same genes” being expressed differently - because of genetic differences in the regulatory regions of at least some of these genes.  The author of this article needs to make clear the distinction between “genes” and “coding regions of genes.”

If anyone wants to see some high-minded stupidity, check out the latest nonsense from John “low low price” Hawks, concerning the NY Times article on cattle-Bison hybridization.

Do read the original Times article before subjecting yourself to Hawks’ hysterical allergy to “genetic purity”, and see what real conservationists have to say on the issue.

Note well that the cattle-Bison hybridization is viewed as harmful, as leading to possible “genomic extinction” of Bison genetics, and note also that scientists studying the problem say that not only is there no evidence of “hybrid vigor” in the cattle-Bison mongrels, but that they find the OPPOSITE to be true.

Hello, Alon Ziv!

And, yes, the mongrel “Bison” look similar to the purebred Bison, and genetic testing is needed to distinguish the two.  After seeing a movie with Virginia Masden, that point is particularly instructive....

Now to Hawks.  The good professor, offended as he is by anything that might smack of “racist” “genetic purity” argues that the mongrelization of the Bison is not a bad thing at all.  Hey, those mongrels have really been reproducing themselves, so it must be great!  According to Hawks, this is all great for “species conservation”; after all, the “genetic variability” may make the hybrids more “adaptive” to changing environments.

Now, I don’t know - is it so difficult to see the flaw in logic there (besides the fact that the conservationists studying the problem are not shy in stating that the cattle genetic introgression has not been helpful)?

If the issue at hand is Bison preservation, then the “adaptiveness” of the competing population of cattle-Bison mongrels is not particularly helpful, is it?  I realize that to some “academics”, “by golly, if it looks like a Bison, boy, that’s good enough for me” is the extent of their conservationist ethos.  But other people may see value in actually preserving the species itself, not having the species replaced by hybrids that have a surface similarity in appearance, but differ in genetic content and other varied phenotypic indicators (eg, disease resistance, among others).

The purpose of species conservation is just that - conserving the species, not altering the species through hybridization and then claiming that the destruction of the species through that hybridization is somehow essential to its “conservation.”

Geez....

And, with respect to the idea that “bison alleles can still compete with cattle alleles” in the population, I have two words as a riposte: genetic structure.

Posted by Buffalo Bill on January 09, 2007, 07:05 PM | #

NY Times
January 9, 2007
Strands of Undesirable DNA Roam With Buffalo
By JIM ROBBINS
MALTA, Mont. — The animals certainly looked like bison, with the characteristic humps and beards. But just to make sure, a pick-up truck slowly rolled up to them, and a bison wrangler shot a drug-filled dart into one of several calves.

A few minutes later the anesthetized animal was on the ground, grunting and squirming. Several men warily moved in to hobble the animal and take blood samples.

This bison wrangling was being done to test the genetics of a herd of 39 animals that is being used by the American Prairie Foundation as seed stock to re-create a large-scale native prairie landscape. The researchers want animals with only pure bison genes, which are not so easy to find.

“The majority of public herds have some level of hybridization with cattle,” said Kyran Kunkel, a World Wildlife Federation biologist who is doing the sampling. “You can’t see any difference visually. But we don’t know what the long-term ecological or biological impacts would be.”

American bison, which teetered on the edge of extinction more than a century ago, are one of the first and perhaps greatest conservation successes, but there is an asterisk next to their species: while bison were being nursed back to viable populations, ranchers who owned them crossed them with cattle.

By the late 19th century, tens of millions of American bison had been reduced to fewer than 1,000, with two dozen or so in Yellowstone National Park, and another 250 in Wood Buffalo National Park in Canada. The balance of the animals were owned by cattle ranchers who wanted to preserve them.

“They purposely crossed bison with domestic cattle to make a better beef animal,” which they called cattelo, said James Derr, a geneticist at the Texas A&M College of Veterinary Medicine. “Bison did better in harsh conditions and are more resistant to parasites and native viral diseases.” (Bison do not contract Texas fever, for example, which afflicts cattle.)

Over time, cattle genes have spread into many of the remaining herds of American bison. Since the late 1990s, Dr. Derr and his graduate students have traveled to public and private bison herds around the country, taking blood samples. They have concluded that the vast majority of the 300,000 or so bison in the United States are hybrids, though they look like pure bison. Fewer than 10,000 bison are genetically uncontaminated.

The research has led to the stark realization that the battle for the long-term preservation of wild bison is not over.

Though cattle genes in affected bison herds make up less than 1 percent of the bison genome, their presence could create serious consequences like weaker disease resistance. “Hybridization makes it hard to predict and hard to manage because their immune response can be all over the place,” Dr. Derr said.

To prevent a “genomic extinction” through hybridization, biologists are focusing on the protection and perpetuation of the herds with pure or nearly pure genetics.

Most immediately, it means separating hybridized from pure bison. The United States Fish and Wildlife Service, for example, has been testing bison on its refuges for several years, moving the pure animals to places where they are isolated or can expand.

What the wildlife service wants, said Matt Kales, a spokesman in Denver, is to avoid “the old eggs-in-one-basket approach.”

Most private herds have some cattle ancestry, which is fine, Dr. Derr said, if the bison are being raised for meat and if long-term conservation is not a concern.

“But if a bison herd has no evidence of cattle genetics, it would be criminal to move bison with cattle genetics into that herd,” he said.

The animals in two federally owned herds, at Yellowstone National Park and Wind Cave National Park, are considered as pure as bison get. (Wind Cave is the source of the American Prairie Foundation herd; lab results are not in yet.)

Other national parks — including Grand Teton, Theodore Roosevelt and Badlands — have bison with very few cattle genes. “The U.S. federal herds are the crown jewels of the bison herd,” Dr. Derr said. “They are healthy, there is no inbreeding, they are pure. That’s an amazingly good thing.”

Though the term “pure” is commonly used in describing such herds, Dr. Derr said, it is technically not accurate because of the limits of DNA testing, which has a 1 percent probability of error. He prefers the phrase “no historic or genetic evidence of hybridization.”

A state-owned herd in Utah and a herd owned by Ted Turner on his Vermejo Park Ranch in New Mexico also show no signs of hybridization.

Unhybridized bison are critical in efforts by the American Prairie Foundation, the Nature Conservancy, the Canadian government and even Mr. Turner to restore large tracts of native prairie and plains that include herds of bison. Establishing new and disparate bison herds will help assure the future of the wild bison.

While the effects of hybridization on bison are not known, Dr. Derr hypothesizes that genetic alterations could change behavior or traits like weight gain and fertility, in addition to disease resistance. “When you mix up two different genomes, you get a lot of different traits, and it’s not completely predictable,” he said.

Hybrid vigor, a cross-breeding response in which a more robust animal is the result, is not the case when cows and bison commingle. “We get just the opposite,” Dr. Derr said.

The selection practiced by bison ranchers also affects the gene pool.

“Ranchers might get rid of a cantankerous bull, for example,” said Curt Freese, a biologist who directs Great Plains bison restoration for the World Wildlife Fund. “Breeding bison to be docile and meaty are the kinds of things that affect the wildness of the bison.”

Keepers of the pure herds are weighing options to protect their genetics.

Many of the herds are small and at risk of inbreeding and loss of diversity, and so must be trucked away to breed with other populations.

In Yellowstone, which has the largest, purest and most genetically diverse herd of wild bison, the plan is to keep the number of bison high.

“We agreed to manage at greater than 2,300 animals to assure conservation of the genome,” said Rick Wallen, a Park Service biologist. “Managing our population at relatively high levels should go a long way toward protecting genetic diversity.”

Managers of these herds must also keep a wary eye on hybridized invaders. In Yellowstone, officials found a domestic bison that had wandered into the wild population from a neighboring ranch. And Wind Cave National Park is adjacent to Custer State Park, where the animals are hybridized.

The new approach may change other aspects of management, as agencies move from managing the species to managing the genetics. Dr. Derr is involved in a study, for instance, of whether the hunting of the bison that leave Yellowstone might be selecting certain behaviors from the population because animals that migrate are targeted.

Dr. Derr said was one of the questions of the study, which should be completed in a year, was “Are they removing family groups?”

“If they are, it’s a biased way to remove herds, and does it have an effect, such as reducing diversity? Those are the questions we’re asking.”

Posted by cattle rustling brute on January 09, 2007, 07:34 PM | #

Thank you, Buffalo Bill.  I’ll just like to stress particular points from the article:

“The animals certainly looked like bison, with the characteristic humps and beards.”

brute: not good enough.

“You can’t see any difference visually. But we don’t know what the long-term ecological or biological impacts would be.”

brute: why it’s not good enough.

“The researchers want animals with only pure bison genes, which are not so easy to find.”

brute: to “low low cost” Hawks, they are just wasting their time. 

“Fewer than 10,000 bison are genetically uncontaminated...The research has led to the stark realization that the battle for the long-term preservation of wild bison is not over.”

brute: note the link between preservation and the requirement of genetically uncontaminated bison.  I assume the term “genetically uncontaminated” gets guys like Hawks real nervous.  Can’t let the rubes make any connections to the human species now, can we?  Nah.  Gotta let “experts” like Hawks do all our thinking for us.  Thanks, Johnny boy.

“Though cattle genes in affected bison herds make up less than 1 percent of the bison genome, their presence could create serious consequences like weaker disease resistance. “Hybridization makes it hard to predict and hard to manage because their immune response can be all over the place,” Dr. Derr said.”

brute: so much for “hybrid vigor.”

“To prevent a “genomic extinction” through hybridization, biologists are focusing on the protection and perpetuation of the herds with pure or nearly pure genetics.”

brute: exactly.  REAL biologists understand that if you want to save the species, then you save that species, not promote the hybridization of the species with another.  Of course, the same applies to sub-species within the same species.  Careful now, rubes, don’t get any wild ideas now.  The “low low cost kid” may disapprove.

“Most immediately, it means separating hybridized from pure bison.”

brute: hey!  Bison separatism!

“The United States Fish and Wildlife Service, for example, has been testing bison on its refuges for several years, moving the pure animals to places where they are isolated or can expand. “

brute: apparently, bison genetic interests require a defined territory, just as human EGI does.

“But if a bison herd has no evidence of cattle genetics, it would be criminal to move bison with cattle genetics into that herd,” he said.”

brute: note, “criminal.” Think about the implication of that, with respect to human population groups that are now demographically endangered.

“The animals in two federally owned herds, at Yellowstone National Park and Wind Cave National Park, are considered as pure as bison get.”

brute: god bless those herds.  may they be fruitful and multiply.

“(Wind Cave is the source of the American Prairie Foundation herd; lab results are not in yet.)”

brute: note, “lab results” are needed.

“The U.S. federal herds are the crown jewels of the bison herd,” Dr. Derr said. “They are healthy, there is no inbreeding, they are pure. That’s an amazingly good thing.”

brute: agreed!  It is an amazingly good thing.  A very very very good thing.  Note as well that the herds can be BOTH pure and without inbreeding (and healthy).  Goddarnit, Alon, I thought we all needed to be mixed up to avoid all those inbred diseases!

“Though the term “pure” is commonly used in describing such herds, Dr. Derr said, it is technically not accurate because of the limits of DNA testing, which has a 1 percent probability of error. He prefers the phrase “no historic or genetic evidence of hybridization.”

brute: sure, and the same applies to humans as well.  There will always be some statistical error, but that’s to be interpreted into the results.  Note that Derr does not deem it necessary to make sarcastic remarks about the “low low cost” of the bison tests.  That they have utility is sufficient.

“A state-owned herd in Utah and a herd owned by Ted Turner on his Vermejo Park Ranch in New Mexico also show no signs of hybridization.”

brute: something good we can say about Ted.

“Unhybridized bison are critical in efforts by the American Prairie Foundation, the Nature Conservancy, the Canadian government and even Mr. Turner to restore large tracts of native prairie and plains that include herds of bison.”

brute: unhybridized are “critical.” But, Hawks knows better.  You conserve the species by replacing them with hybrids.  That’s the ticket!

“While the effects of hybridization on bison are not known, Dr. Derr hypothesizes that genetic alterations could change behavior or traits like weight gain and fertility, in addition to disease resistance. “When you mix up two different genomes, you get a lot of different traits, and it’s not completely predictable,” he said.”

brute: case study - Brazil.

“Hybrid vigor, a cross-breeding response in which a more robust animal is the result, is not the case when cows and bison commingle. “We get just the opposite,” Dr. Derr said.”

brute: Dr. Derr, meet Alon Ziv.

“Keepers of the pure herds are weighing options to protect their genetics.”

brute: where are the human keepers?

“In Yellowstone, which has the largest, purest and most genetically diverse herd of wild bison, the plan is to keep the number of bison high.”

brute: with sufficient numbers, purity and genetic diversity are compatible.

“Managers of these herds must also keep a wary eye on hybridized invaders.”

brute: indeed.  immigration restriction.  Of course, that’s “racism” and must be decried.  It’s “hate” against cattle, don’t you know.

“The new approach may change other aspects of management, as agencies move from managing the species to managing the genetics.”

brute:  “...managing the genetics.” Further comment is superfluous.

Posted by Friedrich Braun on January 09, 2007, 07:39 PM | #

Hi GW, in a slightly different vein, what do you think of Irving’s speech?

http://www.youtube.com/watch?v=MottK8Roem8&mode=related&search=

Posted by costly brute on January 09, 2007, 08:44 PM | #

The “low low cost” kid:

“There is a presumption that the originally bison alleles will be more fit, but today’s conserved situations are very different from those faced by ancient bison. And the historic bison—the ones shot up by Buffalo Bill—were facing a very novel environment compared with their ancestors.”

Question: what does conservation have to do with “fitness?” Consider what happens what humans decide to “conserve” a species.  In this case, humans decide to intervene to save a species which, without this intervention, may become extinct.

If all we cared about was “fitness” in the Hawksian mode, then why not let the Bison just become extinct?  After all, they are not “fit” enough, not “adaptive” enough, to survive the modern world without people intervening to help them.  Let them die off!  But, conservationists say no.

Therefore, it seems that conservation is based not upon a perception of whether the species is “fit enough” (by Hawks’ standards), but whether it is decided that the loss of a specific species is unacceptable, and the species has inherent worth by its own existence.

Whether or not this is “right” or “wrong” to believe is not the issue here - from the perspective of the Bison, if they were sentient, they certainly would speak in favor of their own continuity, they have an ultimate interest in that.  People do not, people choose to care about Bison, independent of Bison having any utility - AND independent of whether Bison are “fit” enough to adapt to the environment.  Once again - if conservationism really did care about what Hawks thinks is fitness, they’d just let endangered species go extinct as “non-fit.”

More to the point: biological fitness is served by the continuity/expansion of the genepool.  Fine.  But look, if the “genetic purity” of certain Bison prompts humans to conserve those Bison and breed them to sufficient numbers, then “genetic purity” is contributing to the fitness of the Bison.  Humans are, after all, part of the Bison environment.  Wasn’t it humans who caused the Bison to nearly go extinct in the first place?  Then, it would seem, that by far, the most important factor in determining the “adaptiveness” of Bison, is what humans think of them.  And, if humans value “pure” Bison, because these are representative of the actual native species that has existed and has become endangered - then “purity” is of adaptive value.  And if hybridization makes the mongrels less attractive to human conservationists - because these endanger the existence and continuity of the native species - then this hybridization is maladaptive.

You can’t have it both ways.  You can’t say that species should be preserved even if they, on their own, cannot adapt to human effects on the environment, and then argue that the criteria for preservation should be whether the species can in fact survive in the new environment.  Once you make the decision that something is worth preserving, then do so.  If it is so not worth preserving that you think it is better off mongrelized, then what’s the point?

More stupidity:

“The best we can hope for is a capacity for adaptation, which will maximize the chance of survival. In that context “genetic purity” is less important than genetic variability.”

The “chance of survival” of what?  Certainly not of the original bison species.  So, you hybridize a species, transforming it into another species - in other words destroying the original species in order to “save it.”

What the hey?  The red wolf is endangered?  Cross-breed them with German Shepherds or with Great Danes, that’ll conserve them, gaddamit!

Probably out of fear of extrapolation to the human condition, Hawks wants us to accept his “idea” that cattle-Bison hybrids are the same thing as unmixed Bison.

Thankfully, Hawks is not a conservationist.

Posted by bison brute on January 09, 2007, 08:51 PM | #

“There is a presumption that the originally bison alleles will be more fit...”

More briefly: one point where Hawks goes off the tracks is his idea that the conservationists care about (or should care about) the “originally bison alleles” because they may be “more fit” (his definition).

While the conservationists do mention some phenotypic consequences of the hybridization, it seems that the real reason for valuing the bison alleles over the cattle alleles is - by golly! - that the whole aim here is to preserve bison and not cattle.

The bison alleles are valued because they are bison, not because they match some naive vision of “fitness.”

The fact that they are valued in fact makes them truly fit, since humans will now intervene to promote the replication of these alleles.  These are the same humans who, previously, via hunting (and enforced miscegenation) diminished these same alleles, so “fair’s fair.”

If humans do the one, they can do the other.  Humans are the environment.

Posted by Desmond Jones on January 09, 2007, 09:37 PM | #

If all we cared about was “fitness” in the Hawksian mode, then why not let the Bison just become extinct?

Which may ultimately be the undoing of highly civilized (EURO) man.

This virtue [humanity, altruism or outgroup sympathy], one of the noblest with which man is endowed, seems to arise incidentally from our sympathies becoming more tender and more widely diffused, until they are extended to all sentient beings. As soon as this virtue is honoured and practised by some few men, it spreads through instruction and example to the young, and eventually becomes incorporated in public opinion.

This “evolved” sympathy for all sentient beings, including the bison, is what is saving the orphans of AIDS in Africa, which in turn has allowed that population to grow substantially and ultimately, that population explosion will force the impending migration out of Africa into the Euro homelands.

Indeed, it has already begun.

Extinction of the bison and instruction in the value of ‘fitness’ would better serve Euro man.

Posted by PF on January 10, 2007, 01:05 PM | #

Can anyone explain to me what it means when they say that chimps and men share 99% or 95% of their DNA?

Does this refer to base pairs, amino acids, or to synteny (analogous/homologous genes in same order)?
Does this only take coding regions into account?

We could have 100% the same genes as another species, and have 25% different alleles, for example. We would be phenotypically completely different from them, no?

Anyone who can shed light on this, it would be greatly appreciated.

Posted by darwinist brute on January 10, 2007, 01:58 PM | #

While I obviously disagree with the anti-evolutionist religious mumbo-jumbo here, and other distortions, the first section is a reasonable layman’s summary of inter-species genetic similarity:

http://www.harunyahya.com/articles/widening_genetic_gap.htm

Posted by PF on January 10, 2007, 03:10 PM | #

Thanks Brute!

If anyone finds out anything about the actual methods used to calculate these numbers, and any critique of it that might exist, please post them here.

The freedom taken in alignment of homologous DNA sequences, if it is like they say in the above article, is a way of not taking insertions and deletions into account. It seem like the new modified method takes indels into account. Here is the old method, and my critique.

Organism 1:

ACCCGTCGATTAGTATACGATGGAGACCAGT

Organism 2:

ACCCGTGATTAGTATACGATGGAGACCT

and guess how these line up?

ACCCGTCGATTAGTATACGATGGAGACCAGT
ACCCGT GATTAGTATACGATGGAGACC T

The difference between these two sequences is only
3 base pairs. That means it has a difference of 9%.

But in practice, that doesnt mean anything,
because this amount of rearrangement is enough
to change the genes effects anywhere from 0 to
100%, and can change the rates of expression
of other genes from -5000% to +5000%.
(strong transcription regulators often alter gene expression
as much as 40 or 50 fold).

For example, lets say a gene encodes an
enzyme that controls glucose utilization.
This 9% difference in one gene could result
in the efficiency of the enzyme being reduced to
60% its normal level. That means a 9% difference
in one coding sequence of one enzyme, if it occurs
in the sensitive, function-essential regions of the enzyme
such as binding motifs, can change the effectivity of the
enzyme anywhere from 0% to 100%. (first case,
having no effect, second case, truncating the enzyme,
rendering it useless).

So a 9% difference can have a 100% difference in the
functionality of a single gene. If we took the entire
sequence of this gene into account, these 3 base pairs
might only be %0.05 different from the comparison
sequence. In fact, given the enormity of coding regions,
that small number is likely not far off.

If we look at genes that control transcription, or genes
that work as part of protein cascades, one gene can
directly effect many many other genes. For example,
Gen A activates B, C, and D. These genes each activate
genes, and so on. Any fluctuation in the expression of
A has a massive effect on the system.

So in the case of a single gene, a 0.05% difference
can easily lead to changes in gene expression of
100% (gene goes from fully functional to non-functional).
In the case of gene cascades, a 0.05% difference
can lead to changes in gene expression of 500% or
5000%.

Example: Transcription factors, repressors and so on.
The inactivation of Hoe3 gene in E. Coli leads to the upregulation of yjjV, to as much as 20-fold or 40-fold.
And the Hoe3 gene could have been turned off with as much as one-base mutation, leading to a stop codon.

You can deactivate the Hoe3 gene theoretically with a stop codon, which is a single base pair change, the coding region is 500 bp, so with a 0.2% change you can accomplish this.
So if a 0.2% sequence change in one coding region of a
gene can effect the expression of other genes up to 4000%,
isnt this idea that base-pair similarity has genetic meaning really silly? Microarrays would take gene expression into account, and lo and behold, the differences in expression even between Chinese and others are much higher [25%, from the other article, if memory serves].

So whenever one mentions this method of determining similarity, one should preface it by saying: This method does not take genetic expression into account.

Microarray data will give us a true picture of what genes are being expressed and how much, in whom.

Posted by PF on January 10, 2007, 03:38 PM | #

Heres a metaphor for why this method of analysis doesnt really work.

Imagine you have an enormous book. The book comprises a huge mix of different things: there are chapters from the bible, poems from e.e. cummings, recipes for housewives, fashion articles for young girls, there is sexual advice, and parts of robotics catalogues spliced in as well, there are pages from a telefone book, there are bits of famous novels, and the epigrams of Martial, and long obscure military histories of the Balkans. All of this is together in one book, an enormous, 1,000,000 page book.

Someone made a second copy of this book and modified it, taking out some things here, and adding new things to it. Viewed as a whole, the books only differ from one another by about 1%. When you look at them, and hold them in your hand, they are basically exactly the same.

So you can look at the book and say: someone reading this will arrive at the same understanding of it as that other book.

But heres whats special about this book: certain special sections of the book determine important things about the reader- the book changes the person reading it.

You might come at the book having had a solid rearing from your parents, but when you read a certain page, your past changes and you become someone who was once molested and abandoned. Or perhaps you started reading as a man, and after reading certain pages, become a woman. Or perhaps you start as an ex-soldier in the Croat army, and after reading certain pages, end up as a French businessman. Certain little pages of the book change the facts of your past and the conditions of your previous life.

And since these pages changed you, they inevitably have an effect on how you choose to continue to read the book. A war-hardened Serb picked up the book and becomes a sweet little girl. A housewife becomes an electrician. A politician becomes a molested orphan. As they change, they alter their reading habits.

But these special pages that change the reader were scattered throughout the book, and no one could properly say where they were. Thus how many of these special sections were altered by this 1% modification, is hard to know.

Therefore, the person who said, ~These two books are only 1% different, therefore two people reading them will be brought to the same understanding upon reading the book~
was wrong. The housewife skipped over the electrical robotic parts, and the electrician skipped the Balkan history, and the Croat skipped the weight-loss tips for girls.

But the books were only 1% different. The understanding of them which the reader has, or to spell out the metaphor clearly, the Phenotype, can nevertheless be very significantly different.

Posted by JB on January 11, 2007, 04:45 AM | #

[quote="Brute"]
After seeing a movie with Virginia Masden, that point is particularly instructive....

everybody claims to have indian blood

from IMDB :

Her father’s parents (Soren and Anna Marie Madsen) came to America from Denmark in the early 1900s. Virginia Madsen is half-Danish.

Both eyes are different. Left eye is part brown and part green and right eye is all green.

Her father is Danish-American; her mother is Irish-American and Aboriginal American.

1/8

World Wildlife Federation

will we have to start walking with our hands for them to notice that we are an endangered race ?

“But if a bison herd has no evidence of cattle genetics, it would be criminal to move bison with cattle genetics into that herd,” he said.

Soren, you should invite Dr.Derr on MR Radio

Post a Comment:

Name: (required)

Email: (required but not displayed)

URL: (optional)

Smileys

You must prefix http://anonym.to/? to gnxp.com links...
e.g., http://anonym.to/?http://www.gnxp.com/...

Copy your comment to the clipboard or paste it somewhere before submitting
it just in case the software loses it because the session time has been exceeded.

Remember my personal information

Notify me of follow-up comments?

Submit the word you see below: (not needed for preview)

captcha shown here

Next entry: Whoops ... back to Iraq and the Glasgow Herald

Previous entry: A Blast from August 3, 2000: The Death of the West

image of the day

Existential Issues

Of note

Majority Radio

Recent Comments

Guessedworker commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 09:59 PM. (go) (view)

Desmond Jones commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 09:06 PM. (go) (view)

Raymond Bradly commented in entry 'Jews: jewish hand-wringing at recent high' on 09/02/10, 09:02 PM. (go) (view)

James Bowery commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 08:45 PM. (go) (view)

Guessedworker commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 08:14 PM. (go) (view)

PF commented in entry 'Machete Ex Machina' on 09/02/10, 06:32 PM. (go) (view)

PF commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 06:28 PM. (go) (view)

John commented in entry 'Machete Ex Machina' on 09/02/10, 03:30 PM. (go) (view)

Notus Wind commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 02:42 PM. (go) (view)

Notus Wind commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 02:31 PM. (go) (view)

Notus Wind commented in entry 'If at first you don't succeed' on 09/02/10, 02:22 PM. (go) (view)

Buzz Killer commented in entry 'Machete Ex Machina' on 09/02/10, 02:13 PM. (go) (view)

Leon Haller commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 02:04 PM. (go) (view)

GoyAmongYou commented in entry 'I nose who you are' on 09/02/10, 02:01 PM. (go) (view)

Thorn commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 01:56 PM. (go) (view)

Leon Haller commented in entry 'If at first you don't succeed' on 09/02/10, 01:52 PM. (go) (view)

Al Birah commented in entry 'Are Jews White?' on 09/02/10, 01:42 PM. (go) (view)

Leon Haller commented in entry 'If at first you don't succeed' on 09/02/10, 01:39 PM. (go) (view)

danielj commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 12:48 PM. (go) (view)

danielj commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 12:45 PM. (go) (view)

qwery commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 12:43 PM. (go) (view)

Mark Dawson commented in entry 'Machete Ex Machina' on 09/02/10, 10:49 AM. (go) (view)

Leon Haller commented in entry 'None dare call it White genocide' on 09/02/10, 10:35 AM. (go) (view)

Leon Haller commented in entry 'None dare call it White genocide' on 09/02/10, 10:27 AM. (go) (view)

Leon Haller commented in entry 'None dare call it White genocide' on 09/02/10, 09:58 AM. (go) (view)

Leon Haller commented in entry 'Machete Ex Machina' on 09/02/10, 09:09 AM. (go) (view)

Guessedworker commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 08:19 AM. (go) (view)

Grimoire commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 08:02 AM. (go) (view)

Grimoire commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 06:19 AM. (go) (view)

Randy Garver commented in entry 'If at first you don't succeed' on 09/02/10, 04:28 AM. (go) (view)

Notus Wind commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 03:56 AM. (go) (view)

Thorn commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 03:28 AM. (go) (view)

Thorn commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 03:18 AM. (go) (view)

uh commented in entry 'The Ontology of Mind: The Gödelian Argument' on 09/02/10, 02:52 AM. (go) (view)

one commented in entry 'If at first you don't succeed' on 09/02/10, 02:38 AM. (go) (view)

General News

Science News

The Writers

Each author's name links to a list of all articles posted by the writer; the hashes link to authors' homepages.

Links

Endorsement not implied.

Crime

General

Immigration

Islam

Jews

Nationalist Political Parties

New Right

Science

Whites in Africa